pLentiPGK Puro DEST ERKKTRClover
(Plasmid #90227)

• Purpose: Lentiviral vector to express ERK KTR mClover under PGK promoter (With Puromycin Resistance)
• Depositing Lab: Markus Covert
• Publication: Kudo et al Nat Protoc. 2018 Jan;13(1):155-169. doi: 10.1038/nprot.2017.128. Epub 2017 Dec 21.

Backbone

• Vector backbone: pLENTI PGK Puro DEST (w529-2)
• Backbone manufacturer: Eric Campeau Lab (Addgene Plasmid 19068)
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ERK Kinase Translocation Reporter
• Species: H. sapiens (human), M. musculus (mouse)
• Promoter: PGK
• Tag / Fusion Protein:
  • mClover (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ACCGAATCACCGACCTCTCT
• 3′ sequencing primer: GCAGCGTATCCACATAGCG

Resource Information

• Supplemental Documents:
  • pkl548-addgene-90227.gb
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry