pCW002
(Plasmid #90225)

• Purpose: GST-STh expression plasmid
• Depositing Lab: James Fleckenstein
• Publication: Zhu et al Infect Immun. 2018 Aug 20. pii: IAI.00526-18. doi: 10.1128/IAI.00526-18.

Backbone

• Vector backbone: pGEX-4t1
• Backbone manufacturer: GE
• Backbone size w/o insert (bp): 4969
• Total vector size (bp): 5047
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sta2
• Alt name: linker sequence + mature ST-H sequence from H10407
• Alt name: from heat-stable enterotoxin A2 precursor (STA2)
• Species: Escherichia coli ETEC H10407
• Insert Size (bp): 78
• Mutation: linker sequence GATCCCCGGGTACCGAGCTCG between BamH1 and ST
• GenBank ID: FN649418.1 NC_017724
• Promoter: Ptac
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH1 (not destroyed)
• 3′ cloning site: EcoR1 (not destroyed)
• 5′ sequencing primer: ccagcaagtatatagcatgg
• 3′ sequencing primer: cgcttacagacaagctgtg

Resource Information

• Supplemental Documents:
  • pCW002.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid when expressed in E. coli will produce a fusion protein of GST and the ST-H (ST1b) heat stable toxin. It is not likely that the toxin will be secreted under these conditions. It will likely only have biological activity when purified, and the ST-H peptide fragment is liberated by thrombin cleavage.