Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCSC-NGN2-IRES-GFP-T2A-Sox11
(Plasmid #90214)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90214 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCSC-SP-PW-IRES-GFP
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NGN2-IRES-GFP-T2A-Sox11
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Entrez Gene
    NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
  • Entrez Gene
    Sox11 (a.k.a. 1110038H03Rik, 6230403H02Rik, AI836553, end, end1)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer agctcgtttagtgaaccgtcagatc
  • 3′ sequencing primer gagcaacatagttaagaataccag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

WARNING: This plasmid is highly unstable. You may need to screen several DNA preps to isolate the intact construct. We recommend performing a restriction digest to confirm the plasmid has not recombined.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCSC-NGN2-IRES-GFP-T2A-Sox11 was a gift from Chun-Li Zhang (Addgene plasmid # 90214 ; http://n2t.net/addgene:90214 ; RRID:Addgene_90214)
  • For your References section:

    Direct Lineage Reprogramming Reveals Disease-Specific Phenotypes of Motor Neurons from Human ALS Patients. Liu ML, Zang T, Zhang CL. Cell Rep. 2016 Jan 5;14(1):115-28. doi: 10.1016/j.celrep.2015.12.018. Epub 2015 Dec 24. 10.1016/j.celrep.2015.12.018 PubMed 26725112