pCSC-NGN2-IRES-GFP-T2A-Sox11
(Plasmid #90214)

• Purpose: To convert human skin fibroblasts into induced motor neurons (hiMN) in combination with ISL1, LHX3, FGF2 and two small molecules, forskolin and dorsomorphin.
• Depositing Lab: Chun-Li Zhang
• Publication: Liu et al Cell Rep. 2016 Jan 5;14(1):115-28. doi: 10.1016/j.celrep.2015.12.018. Epub 2015 Dec 24.

Backbone

• Vector backbone: pCSC-SP-PW-IRES-GFP
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NGN2-IRES-GFP-T2A-Sox11
• Species: H. sapiens (human), M. musculus (mouse)
• Entrez Gene: NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
• Entrez Gene: Sox11 (a.k.a. 1110038H03Rik, 6230403H02Rik, AI836553, end, end1)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: agctcgtttagtgaaccgtcagatc
• 3′ sequencing primer: gagcaacatagttaagaataccag

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

WARNING: This plasmid is highly unstable. You may need to screen several DNA preps to isolate the intact construct. We recommend performing a restriction digest to confirm the plasmid has not recombined.