pLNCX2-NGN2-IRES-GFP
(Plasmid
#90212)
-
PurposeTo convert human fetal lung fibroblasts into induced cholinergic neurons (hiCN) in combination with two small molecules, forskolin and dorsomorphin.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90212 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLNCX2
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNGN2-IRES-GFP
-
SpeciesH. sapiens (human)
-
Entrez GeneNEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer cctcacattgccaaaagacg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLNCX2-NGN2-IRES-GFP was a gift from Chun-Li Zhang (Addgene plasmid # 90212 ; http://n2t.net/addgene:90212 ; RRID:Addgene_90212) -
For your References section:
Small molecules enable neurogenin 2 to efficiently convert human fibroblasts into cholinergic neurons. Liu ML, Zang T, Zou Y, Chang JC, Gibson JR, Huber KM, Zhang CL. Nat Commun. 2013;4:2183. doi: 10.1038/ncomms3183. 10.1038/ncomms3183 PubMed 23873306