Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

1270 pBabe puroL Myr HA Akt1 Notes

Sequence showing no myr tag from Joerg Huelsken

Sequence with pBABE5':
CTCCTTCTCTAGGCGCCGGCCGGATCGAAGACTAAGCTTACCATGGCCTACCCCTACGAC
GTGCCCGACTACGCCTCCCTCGGATCCATGAGCGACGTGGCTATTGTGAAGGAGGGTTGG
CTGCACAAACGAGGGGAGTACATCAAGACCTGGCGGCCACGCTACTTCCTCCTCAAGAAT