Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

LP698
(Plasmid #90179)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90179 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5939
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    KIF13B
  • Alt name
    GAKIN
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1239
  • Mutation
    aa residues 1289-1702
  • GenBank ID
    NM_015254.3
  • Entrez Gene
    KIF13B (a.k.a. GAKIN)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHi (not destroyed)
  • 5′ sequencing primer EGFP-C: CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer SV40pA-R: GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert PCR-amplified from plasmid received from Dr. Athar Chishti, Tufts University School of Medicine (pEGFP-C1 with full-length GAKIN/KIF13B; Asaba et al. J. Biol. Chem. 2003, PMID: 12496241)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LP698 was a gift from Lotte Pedersen (Addgene plasmid # 90179 ; http://n2t.net/addgene:90179 ; RRID:Addgene_90179)
  • For your References section:

    KIF13B establishes a CAV1-enriched microdomain at the ciliary transition zone to promote Sonic hedgehog signalling. Schou KB, Mogensen JB, Morthorst SK, Nielsen BS, Aleliunaite A, Serra-Marques A, Furstenberg N, Saunier S, Bizet AA, Veland IR, Akhmanova A, Christensen ST, Pedersen LB. Nat Commun. 2017 Jan 30;8:14177. doi: 10.1038/ncomms14177. 10.1038/ncomms14177 PubMed 28134340