6-His-MBP-TEV-FnCpf1
(Plasmid #90094)

• Purpose: Bacterial expression plasmid for protein purification
• Depositing Lab: Feng Zhang
• Publication: Zetsche et al Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.

Backbone

• Vector backbone: pET-28
• Backbone size w/o insert (bp): 6643
• Total vector size (bp): 10553
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: FnCpf1 (humanized)
• Alt name: type V CRISPR-associated protein Cpf1 (humanized)
• Alt name: Cpf1 (humanized)
• Alt name: Francisella tularensis subsp. novicida U112 Cpf1 (humanized)
• Species: Francisella tularensis subsp. novicida U112
• Insert Size (bp): 3910
• Promoter: T7
• Tags / Fusion Proteins:
  • 6xHis (N terminal on backbone)
  • MBP (N terminal on insert)
  • TEV site (N terminal on insert)
  • Nucleoplasmin NLS (C terminal on insert)
  • 3xHA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (unknown if destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: taatacgactcactataggg�

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: a Flag-AviTag containing fragment follows the insert (between the XhoI and HindIII sites) but this sequence is not translated.