Skip to main content
Addgene

pLKO.1-shDsup
(Plasmid #90024)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90024 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1 puro
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dsup
  • Alt name
    LC050827
  • gRNA/shRNA sequence
    ACCGGTGAACGTAACCGTTACCAAAGGTTCAAGAGACCTTTGGTAACGGTTACGTTCTTTTTGAATTC
  • Species
    Ramazzottius varieornatus

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert species is Ramazzottius varieornatus

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-shDsup was a gift from Takekazu Kunieda (Addgene plasmid # 90024 ; http://n2t.net/addgene:90024 ; RRID:Addgene_90024)
  • For your References section:

    Extremotolerant tardigrade genome and improved radiotolerance of human cultured cells by tardigrade-unique protein. Hashimoto T, Horikawa DD, Saito Y, Kuwahara H, Kozuka-Hata H, Shin-I T, Minakuchi Y, Ohishi K, Motoyama A, Aizu T, Enomoto A, Kondo K, Tanaka S, Hara Y, Koshikawa S, Sagara H, Miura T, Yokobori S, Miyagawa K, Suzuki Y, Kubo T, Oyama M, Kohara Y, Fujiyama A, Arakawa K, Katayama T, Toyoda A, Kunieda T. Nat Commun. 2016 Sep 20;7:12808. doi: 10.1038/ncomms12808. 10.1038/ncomms12808 PubMed 27649274