pSF3-Flag-Cbir-Ago2_Myc-Nbir-Dicer
(Plasmid
#90013)
-
PurposeSplit-BioID plasmid: Expresses N-terminally tagged CBir[257-321]-Ago2 and N-terminally tagged NBir[2-256]-Dicer
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90013 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSF3
- Total vector size (bp) 16239
-
Vector typeMammalian Expression, Retroviral ; Flp/FRT
-
Selectable markersHygromycin ; Ganciclovir (negative selection when making stable cell lines)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCBirA*-Ago2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2880
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer tatactttctagagaataggaac (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNBirA*-Dicer
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6636
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GTGGTTTGTCCAAACTCATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypIRESneo –FLAG/ HA Ago2 kind gift from Gunter Meister CMV-Dicer was a kind gift from Dirk Grimm Addgene plasmids: pCDNA3.1-MycBioID (#35700) kind gift from Kyle Roux
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSF3-Flag-Cbir-Ago2_Myc-Nbir-Dicer was a gift from Julien Béthune (Addgene plasmid # 90013 ; http://n2t.net/addgene:90013 ; RRID:Addgene_90013) -
For your References section:
Split-BioID a conditional proteomics approach to monitor the composition of spatiotemporally defined protein complexes. Schopp IM, Amaya Ramirez CC, Debeljak J, Kreibich E, Skribbe M, Wild K, Bethune J. Nat Commun. 2017 Jun 6;8:15690. doi: 10.1038/ncomms15690. 10.1038/ncomms15690 PubMed 28585547