pSF3-Flag-Cbir-Cdc25C WT_Myc-Nbir-GFP
(Plasmid #90012)

• Purpose: Split-BioID plasmid: Expresses N-terminally tagged CBir[257-321]-Cdc25C and N-terminally tagged NBir[2-256]-GFP
• Depositing Lab: Julien Béthune
• Publication: Schopp et al Nat Commun. 2017 Jun 6;8:15690. doi: 10.1038/ncomms15690.

Backbone

• Vector backbone: pSF3
• Total vector size (bp): 10074
• Vector type: Mammalian Expression, Retroviral ; Flp/FRT
• Selectable markers: Hygromycin ; Ganciclovir (negative selection when making stable cell lines)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: CBirA*-Cdc25C
• Species: H. sapiens (human)
• Insert Size (bp): 1728
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: tatactttctagagaataggaac

Gene/Insert 2

• Gene/Insert name: NBirA*-GFP
• Insert Size (bp): 1590
• Promoter: CMV
• Tag / Fusion Protein:
  • Myc (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GTGGTTTGTCCAAACTCATC

Resource Information

• Supplemental Documents:
  • pSF3-FLAG-CBir-cdc25c_Myc-NBir-GFP.gb
• A portion of this plasmid was derived from a plasmid made by: Addgene plasmids: GFP cdc25c (#10969) a kind gift from Toren Finkel and pCDNA3.1-MycBioID (#35700) kind gift from Kyle Roux

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: This plasmid contains an N147D mutation GFP, but the depositor confirms that it has no affect on plasmid function.