pSF3-Flag-Cbir-Cdc25C S216A_Myc-Nbir-14-3-3e
(Plasmid #90011)

• Purpose: Split-BioID plasmid: Expresses N-terminally tagged CBir[257-321]-Cdc25C S216A and N-terminally tagged NBir[2-256]-14-3-3e
• Depositing Lab: Julien Béthune
• Publication: Schopp et al Nat Commun. 2017 Jun 6;8:15690. doi: 10.1038/ncomms15690.

Backbone

• Vector backbone: pSF3
• Total vector size (bp): 10119
• Vector type: Mammalian Expression, Retroviral ; Flp/FRT
• Selectable markers: Hygromycin ; Ganciclovir (negative selection when making stable cell lines)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: CBirA*-Cdc25C S216A
• Species: H. sapiens (human)
• Insert Size (bp): 1728
• Mutation: Ser 216 to Ala
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: tatactttctagagaataggaac

Gene/Insert 2

• Gene/Insert name: NBirA*-14-3-3e
• Species: H. sapiens (human)
• Insert Size (bp): 1635
• Promoter: CMV
• Tag / Fusion Protein:
  • Myc (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GTGGTTTGTCCAAACTCATC

Resource Information

• Supplemental Documents:
  • pSF3_FLAG-CBir-cdc25cS216A_Myc-NBir-YWHAE.gb
• A portion of this plasmid was derived from a plasmid made by: Addgene plasmids: pQTEV-YWHAE (#31562) a kind gift from Konrad Buessow and GFP cdc25c (#10969) a kind gift from Toren Finkel and pCDNA3.1-MycBioID (#35700) kind gift from Kyle Roux
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry