pSF3-Flag-FRB-Cbir_FKBP-Myc-Nbir
(Plasmid #90009)

• Purpose: Split-BioID plasmid: Expresses C-terminally tagged CBir[257-321]-FRB and C-terminally tagged NBir[2-256]-FKBP
• Depositing Lab: Julien Béthune
• Publication: Schopp et al Nat Commun. 2017 Jun 6;8:15690. doi: 10.1038/ncomms15690.

Backbone

• Vector backbone: pSF3
• Total vector size (bp): 8585
• Vector type: Mammalian Expression, Retroviral ; Flp/FRT
• Selectable markers: Hygromycin ; Ganciclovir (negative selection when making stable cell lines)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: FKBP-linker-Myc-NBirA*
• Insert Size (bp): 1233
• Promoter: CMV
• Tag / Fusion Protein:
  • Myc

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: GTGGTTTGTCCAAACTCATC

Gene/Insert 2

• Gene/Insert name: FRB-linker-CBirA*
• Insert Size (bp): 627
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: tatactttctagagaataggaac

Resource Information

• Supplemental Documents:
  • pSF3-FLAG-FRB-CBir_FKBP-Myc-NBir.gb
• A portion of this plasmid was derived from a plasmid made by: Addgene plasmids: pLXIN-Ap1g1-FKBP (#46946) and pEYFP-Mitotrap (#46942) kind gifts from Margaret Robinson and pCDNA3.1-MycBioID (#35700) kind gift from Kyle Roux

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry