CAG-SaCas9-WPRE
(Plasmid #89996)

• Purpose: Expresses high levels of WT SaCas9 for genome editing
• Depositing Lab: Timo Otonkoski
• Publication: Balboa et al Stem Cell Res. 2017 Jul;22:16-19. doi: 10.1016/j.scr.2017.05.005. Epub 2017 May 17.

Backbone

• Vector backbone: pCAG
• Total vector size (bp): 8876
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SaCas9
• Species: Staphylococcus aureus
• Entrez Gene: NEWENTRY
• Promoter: CAG
• Tags / Fusion Proteins:
  • SV40 NLS (N terminal on insert)
  • Nucleoplasmin NLS (C terminal on insert)
  • 3xHA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: pCAG-F GCAACGTGCTGGTTATTGTG
• 3′ sequencing primer: M13 Reverse CAGGAAACAGCTATGAC

Resource Information

• Supplemental Documents:
  • CAG-SaCas9-WPRE.gb
• A portion of this plasmid was derived from a plasmid made by: SaCas9 was cloned from pX601 plasmid (a gift from Feng Zhang, Addgene plasmid # 61591)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry