CAG-Cas9
(Plasmid #89995)

• Purpose: Expresses high levels of WT Cas9 for genome editing
• Depositing Lab: Timo Otonkoski
• Publication: Balboa et al Stem Cell Res. 2017 Aug;23:105-108. doi: 10.1016/j.scr.2017.07.006. Epub 2017 Jul 11.

Backbone

• Vector backbone: pCAG
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hCas9
• Species: Streptococcus pyogenes
• Promoter: CAG
• Tags / Fusion Proteins:
  • 3xFlag (N terminal on insert)
  • SV40 NLS (N terminal on insert)
  • SV40 NLS (C terminal on insert)
  • T2A peptide (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: pCAG-F GCAACGTGCTGGTTATTGTG
• 3′ sequencing primer: M13 Reverse CAGGAAACAGCTATGAC

Resource Information

• Supplemental Documents:
  • CAG-Cas9.gb
• A portion of this plasmid was derived from a plasmid made by: SaCas9 was cloned from pX330 plasmid (a gift from Feng Zhang, Addgene plasmid # 42230)
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry