CAG-Cas9
(Plasmid
#89995)
-
PurposeExpresses high levels of WT Cas9 for genome editing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89995 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehCas9
-
SpeciesStreptococcus pyogenes
- Promoter CAG
-
Tags
/ Fusion Proteins
- 3xFlag (N terminal on insert)
- SV40 NLS (N terminal on insert)
- SV40 NLS (C terminal on insert)
- T2A peptide (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer pCAG-F GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer M13 Reverse CAGGAAACAGCTATGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySaCas9 was cloned from pX330 plasmid (a gift from Feng Zhang, Addgene plasmid # 42230)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-Cas9 was a gift from Timo Otonkoski (Addgene plasmid # 89995 ; http://n2t.net/addgene:89995 ; RRID:Addgene_89995) -
For your References section:
Generation of an OCT4 reporter human induced pluripotent stem cell line using CRISPR/SpCas9. Balboa D, Weltner J, Novik Y, Eurola S, Wartiovaara K, Otonkoski T. Stem Cell Res. 2017 Aug;23:105-108. doi: 10.1016/j.scr.2017.07.006. Epub 2017 Jul 11. 10.1016/j.scr.2017.07.006 PubMed 28925359