pUC19-SOX2-T2A-2xNLS-tdTomato-F2A-Puro
(Plasmid #89991)

• Purpose: Donor template for generation of SOX2-ntdTomato reporter cell lines
• Depositing Lab: Timo Otonkoski
• Publication: Balboa et al Stem Cell Res. 2017 Jul;22:16-19. doi: 10.1016/j.scr.2017.05.005. Epub 2017 May 17.

Backbone

• Vector backbone: pUC19
• Backbone size w/o insert (bp): 2657
• Total vector size (bp): 6324
• Vector type: CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SOX2-T2A-2xNLS-TdTomato-F2A-Puro
• Species: H. sapiens (human)
• Insert Size (bp): 3667
• Entrez Gene: SOX2 (a.k.a. ANOP3, MCOPS3)
• Promoter: none

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: M13-fwd tgtaaaacgacggccagt
• 3′ sequencing primer: M13-rv caggaaacagctatgaccatg

Resource Information

• Supplemental Documents:
  • pUC19-SOX2-T2A-2nTdTomato-F2A-Puro.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: TdTomato sequence was cloned from pCSCMV:tdTomato (a gift from Gerhart Ryffel, Addgene plasmid #30530).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry