-
PurposeModified from pCas9-CR4 (Addgene: 62655) to use the high-fidelity version of Cas9, SpCas9-HF1 (N497A/R661A/Q695A/Q926A) from Kleinstiver et al 2016.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89961 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCas9-CR4
- Total vector size (bp) 7859
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCas9HF1
-
SpeciesS. pyogenes
-
MutationN497A/R661A/Q695A/Q926A
- Promoter pTet
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer taagaaggctggctctgcac (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This Cas9 has been modified to contain the high-fidelity mutations for SpCas9-HF1 from Kleinstiver et al 2016
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEM-Cas9HF1 was a gift from Michael Lynch (Addgene plasmid # 89961 ; http://n2t.net/addgene:89961 ; RRID:Addgene_89961) -
For your References section:
Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. Moreb EA, Hoover B, Yaseen A, Valyasevi N, Roecker Z, Menacho-Melgar R, Lynch MD. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174. 10.1021/acssynbio.7b00174 PubMed 28915012