pKDsgRNA-hisG
(Plasmid
#89954)
-
PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting hisG.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89954 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKD46
- Total vector size (bp) 6959
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehisG gRNA
-
gRNA/shRNA sequencegccgaaatccagacgacgca
- Promoter pTet
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ttctcagggcgttttatggc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKDsgRNA-hisG was a gift from Michael Lynch (Addgene plasmid # 89954 ; http://n2t.net/addgene:89954 ; RRID:Addgene_89954) -
For your References section:
Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. Moreb EA, Hoover B, Yaseen A, Valyasevi N, Roecker Z, Menacho-Melgar R, Lynch MD. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174. 10.1021/acssynbio.7b00174 PubMed 28915012