pMRXIP-3xMyc-STX17FL
(Plasmid
#89942)
-
PurposeExpresses syntaxin17 tagged with Myc in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89942 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMRXIP GFP-Ci2
-
Backbone manufacturerDr.Shoji Yamaoka of Tokyo Medical and Dental University
- Backbone size w/o insert (bp) 6249
- Total vector size (bp) 7165
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman syntaxin17
-
Alt nameSTX17
-
SpeciesH. sapiens (human)
-
Insert Size (bp)916
-
GenBank IDNM_017919
-
Entrez GeneSTX17
-
Tag
/ Fusion Protein
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GTTCGCGAGTTAACGGATCCGATGTCTGAAGATGAA
- 3′ sequencing primer AGCGGCCGCTCGAGGgatccTTAACTGCATTTCTTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byIt has the pMX backbone
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRXIP-3xMyc-STX17FL was a gift from Noboru Mizushima (Addgene plasmid # 89942 ; http://n2t.net/addgene:89942 ; RRID:Addgene_89942) -
For your References section:
Accumulation of undegraded autophagosomes by expression of dominant-negative STX17 (syntaxin 17) mutants. Uematsu M, Nishimura T, Sakamaki Y, Yamamoto H, Mizushima N. Autophagy. 2017 Aug 3;13(8):1452-1464. doi: 10.1080/15548627.2017.1327940. Epub 2017 Jun 9. 10.1080/15548627.2017.1327940 PubMed 28598244