pMRXIP Lamp1-Venus
(Plasmid
#89937)
-
PurposeExpresses Lamp1 tagged with Venus in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89937 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMRXIP Venus-N
-
Backbone manufacturerDr.Shoji Yamaoka of Tokyo Medical and Dental University
- Backbone size w/o insert (bp) 6832
- Total vector size (bp) 8053
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerat Lamp1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1221
-
GenBank IDNM_012857.2
-
Entrez GeneLamp1 (a.k.a. LGP120)
-
Tag
/ Fusion Protein
- Venus (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer gacgGAATTCatGCCATGGCGGCCCC
- 3′ sequencing primer GATGGTCTGATAGCCCGCGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byIt has the pMX backbone
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRXIP Lamp1-Venus was a gift from Noboru Mizushima (Addgene plasmid # 89937 ; http://n2t.net/addgene:89937 ; RRID:Addgene_89937) -
For your References section:
The ATG conjugation systems are important for degradation of the inner autophagosomal membrane. Tsuboyama K, Koyama-Honda I, Sakamaki Y, Koike M, Morishita H, Mizushima N. Science. 2016 Nov 25;354(6315):1036-1041. Epub 2016 Oct 20. 10.1126/science.aaf6136 PubMed 27885029