pCMV sMTase (eGFP)
(Plasmid #89930)

• Purpose: Expresses sMTase system for targeted DNA methylation in mammalian cells. Contains an eGFP marker expressed off separate promoter.
• Depositing Lab: Carl Novina
• Publication: Xiong et al Sci Rep. 2017 Jul 27;7(1):6732. doi: 10.1038/s41598-017-06757-0.

Backbone

• Vector backbone: pCMV
• Backbone size w/o insert (bp): 4156
• Total vector size (bp): 10312
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB 10-beta or ER2267
• Growth instructions: Requires strain that is tolerant of CpG methylation
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9-MC-IRES-MN
• Alt name: NLS-Flag-dCas9-lfl-M.SssI[273-386]-NLS - IRES - NLS-HA-M.SssI[2-272]
• Insert Size (bp): 6156
• Mutation: deactivated Cas9
• Promoter: CMV
• Tags / Fusion Proteins:
  • Flag (N terminal on insert)
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGTGTACGGTGGGAGG
• 3′ sequencing primer: gcttgccaaacctacaggtgg

Resource Information

• Supplemental Documents:
  • pCMV sMTase eGFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry