pLenti-rInsp-hIns-GLuc
(Plasmid
#89927)
-
PurposeExpresses Insulin-GLuc from the rat insulin promoter. Gaussia Luc is inserted within the C-peptide and is co-secreted with insulin.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89927 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRRL-SV40-puro
- Backbone size w/o insert (bp) 7131
- Total vector size (bp) 8425
-
Modifications to backboneDerived from pLenti-EKAR2G2 (Addgene plasmid # 40178) digested with XhoI and ClaI to remove the promoter and EKAR2G2 insert.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehuman insulin-Gaussia-Luciferase
-
Alt namehIns-GLuc
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)849
-
MutationDNA sequence for Gaussia luciferase was humanized and two mutations (M43I/M110I) were made to enhance glow-like kinetics.
-
Entrez GeneINS (a.k.a. IDDM, IDDM1, IDDM2, ILPR, IRDN, MODY10, PNDM4)
- Promoter 410bp rat insulin II promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTCTTTGTCGCCTTCGTAGG
- 3′ sequencing primer CCTACGAAGGCGACAAAGAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was generated from plasmid 89928 by cloning the promoter+reporter region into the pLenti backbone. The pLenti backbone came from Addgene plasmid 40178.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-rInsp-hIns-GLuc was a gift from Melanie Cobb (Addgene plasmid # 89927 ; http://n2t.net/addgene:89927 ; RRID:Addgene_89927) -
For your References section:
Insulin promoter-driven Gaussia luciferase-based insulin secretion biosensor assay for discovery of beta-cell glucose-sensing pathways. Kalwat MA, Wichaidit C, Nava Garcia AY, McCoy MK, McGlynn K, Hwang IH, MacMillan JB, Posner BA, Cobb MH. ACS Sens. 2016 Oct 28;1(10):1208-1212. Epub 2016 Oct 12. 10.1021/acssensors.6b00433 PubMed 27819058