Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-rInsp-hIns-GLuc
(Plasmid #89927)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89927 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRRL-SV40-puro
  • Backbone size w/o insert (bp) 7131
  • Total vector size (bp) 8425
  • Modifications to backbone
    Derived from pLenti-EKAR2G2 (Addgene plasmid # 40178) digested with XhoI and ClaI to remove the promoter and EKAR2G2 insert.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    human insulin-Gaussia-Luciferase
  • Alt name
    hIns-GLuc
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    849
  • Mutation
    DNA sequence for Gaussia luciferase was humanized and two mutations (M43I/M110I) were made to enhance glow-like kinetics.
  • Entrez Gene
    INS (a.k.a. IDDM, IDDM1, IDDM2, ILPR, IRDN, MODY10, PNDM4)
  • Promoter 410bp rat insulin II promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTCTTTGTCGCCTTCGTAGG
  • 3′ sequencing primer CCTACGAAGGCGACAAAGAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was generated from plasmid 89928 by cloning the promoter+reporter region into the pLenti backbone. The pLenti backbone came from Addgene plasmid 40178.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-rInsp-hIns-GLuc was a gift from Melanie Cobb (Addgene plasmid # 89927 ; http://n2t.net/addgene:89927 ; RRID:Addgene_89927)
  • For your References section:

    Insulin promoter-driven Gaussia luciferase-based insulin secretion biosensor assay for discovery of beta-cell glucose-sensing pathways. Kalwat MA, Wichaidit C, Nava Garcia AY, McCoy MK, McGlynn K, Hwang IH, MacMillan JB, Posner BA, Cobb MH. ACS Sens. 2016 Oct 28;1(10):1208-1212. Epub 2016 Oct 12. 10.1021/acssensors.6b00433 PubMed 27819058