pPbcsx28
(Plasmid
#89909)
-
PurposeExpresses csx28 from P. buccae ATCC 33574 in bacteria. Expression driven from the Lac promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89909 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 2686
- Total vector size (bp) 3264
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecsx28
-
SpeciesP. buccae ATCC 33574
-
Insert Size (bp)534
- Promoter Lac
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atgccggtactgccgggcctcttgcgggat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byFrom genomic DNA of P. buccae ATCC 33574 purchased from ATCC.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Benchling sequence link: https://benchling.com/s/3MmA04ct
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPbcsx28 was a gift from Feng Zhang (Addgene plasmid # 89909 ; http://n2t.net/addgene:89909 ; RRID:Addgene_89909) -
For your References section:
Cas13b Is a Type VI-B CRISPR-Associated RNA-Guided RNase Differentially Regulated by Accessory Proteins Csx27 and Csx28. Smargon AA, Cox DB, Pyzocha NK, Zheng K, Slaymaker IM, Gootenberg JS, Abudayyeh OA, Essletzbichler P, Shmakov S, Makarova KS, Koonin EV, Zhang F. Mol Cell. 2017 Feb 16;65(4):618-630.e7. doi: 10.1016/j.molcel.2016.12.023. Epub 2017 Jan 5. 10.1016/j.molcel.2016.12.023 PubMed 28065598