pBZCas13b-HEPN
(Plasmid #89901)

• Purpose: Bacterial expression for bzCas13b and crRNA with both HEPN domains mutated. New spacers can be cloned by digesting with BsaI.
• Depositing Lab: Feng Zhang
• Publication: Smargon et al Mol Cell. 2017 Feb 16;65(4):618-630.e7. doi: 10.1016/j.molcel.2016.12.023. Epub 2017 Jan 5.

Backbone

• Vector backbone: pACYC184
• Backbone size w/o insert (bp): 4245
• Total vector size (bp): 8098
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Cas13b
• Species: B. zoohelcum ATCC 43767
• Insert Size (bp): 3672
• Mutation: R116A/H121A/R1177A/H1182A
• Promoter: Lac

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: atgccggtactgccgggcctcttgcgggat

Resource Information

• Supplemental Documents:
  • pbzcas13b-HEPN.gb
• A portion of this plasmid was derived from a plasmid made by: Cloned from genomic DNA purchased from ATCC of B. zoohelcum ATCC 43767.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Benchling sequence link: https://benchling.com/s/seq-gyNy5vRceFfoBk3kqStl