Skip to main content
Addgene

pMT2 Alpha2 delta-1 V6
(Plasmid #89894)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89894 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMT2
  • Backbone size w/o insert (bp) 5129
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cacna2d1
  • Alt name
    Alpha2delta-1
  • Species
    R. norvegicus (rat)
  • Mutation
    Amino acids L943V, E944V, A945V, E947V, M948V are mutated.
  • Entrez Gene
    Cacna2d1 (a.k.a. CCHLA2, Cacna2, DHSCCA)
  • Promoter adenovirus major late promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer 5' agcttgaggtgtggcaggctt 3'
  • 3′ sequencing primer 5' ggtcgaaccatgatggcagc 3'
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5 amino acids are mutated to valines in the region believe to be involved in post translational cleavage of the alpha2 and delta-1 moities (there is already a Valine at AA position 946) leading to a stretch of 6 valines

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMT2 Alpha2 delta-1 V6 was a gift from Annette Dolphin (Addgene plasmid # 89894 ; http://n2t.net/addgene:89894 ; RRID:Addgene_89894)

  • For your References section:

    Proteolytic maturation of alpha2delta represents a checkpoint for activation and neuronal trafficking of latent calcium channels. Kadurin I, Ferron L, Rothwell SW, Meyer JO, Douglas LR, Bauer CS, Lana B, Margas W, Alexopoulos O, Nieto-Rostro M, Pratt WS, Dolphin AC. Elife. 2016 Oct 26;5. pii: e21143. doi: 10.7554/eLife.21143. 10.7554/eLife.21143 PubMed 27782881
Related items:
Commonly requested with: