pMT2 Beta1b mCherry
(Plasmid #89892)

• Purpose: Mammalian expression of Beta1b mCherry
• Depositing Lab: Annette Dolphin
• Publication: Page et al J Biol Chem. 2016 Sep 23;291(39):20402-16. doi: 10.1074/jbc.M116.737270. Epub 2016 Aug 3.

Backbone

• Vector backbone: pMT2
• Backbone size w/o insert (bp): 5129
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cacnb1
• Alt name: Beta1b
• Species: R. norvegicus (rat)
• Insert Size (bp): 2658
• Mutation: mCherry sequence inserted just before the Stop codon
• Entrez Gene: Cacnb1 (a.k.a. CAB1)
• Promoter: adenovirus major late promoter
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: 5' agcttgaggtgtggcaggctt 3'
• 3′ sequencing primer: 5' ggtcgaaccatgatggcagc 3'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cut out B1b with EcoRI and SpeI (but then you lose the start codon), cut out mCherry with SpeI and NotI (but then you lose the Stop codon). The mCherry is missing the N-terminal start codon. The SpeI site introduces 2 extra amino acids: Threonine and serine. Cut out the entire insert with EcoRI and NotI.