pMT2 Cav2.2 DomI and DomII
(Plasmid
#89891)
-
PurposeMammalian expression of Cav2.2 DomI and DomII, this contains the first 2 domains (amino acids 1 -1154) of Cav2.2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89891 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMT2
- Backbone size w/o insert (bp) 5129
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCacna1b
-
Alt nameAlpha1B
-
Insert Size (bp)3505
-
MutationStop codon after amino acid 1154 (this is a truncated form of the wild type gene)
-
Entrez GeneCACNA1B
- Promoter adenovirus major late promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer 5' agcttgaggtgtggcaggctt 3'
- 3′ sequencing primer 5' ggtcgaaccatgatggcagc 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Contains Cav2.2 N-terminus, Domain I, the I-II loop, Domain II and the II-III loop.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMT2 Cav2.2 DomI and DomII was a gift from Annette Dolphin (Addgene plasmid # 89891 ; http://n2t.net/addgene:89891 ; RRID:Addgene_89891) -
For your References section:
Dominant-negative synthesis suppression of voltage-gated calcium channel Cav2.2 induced by truncated constructs. Raghib A, Bertaso F, Davies A, Page KM, Meir A, Bogdanov Y, Dolphin AC. J Neurosci. 2001 Nov 1;21(21):8495-504. 21/21/8495 [pii] PubMed 11606638