Skip to main content
Addgene

pGEM BirA-2A-Citrine-SV40pA-FRT-Kan-FRT
(Plasmid #89890)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89890 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGEM-GFP-SV40pA-FRT-Kan-FRT
  • Backbone size w/o insert (bp) 4780
  • Total vector size (bp) 6644
  • Vector type
    Unspecified

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HA-BirA-2A-citrine
  • Species
    D. rerio (zebrafish), Synthetic
  • Insert Size (bp)
    1864
  • Tag / Fusion Protein
    • Citrine (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacII (unknown if destroyed)
  • 3′ cloning site BsrgI (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer ATTTAGGTGACACTATAGAA
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pGEM-NLS-BirA-2A-mCherry-SV40pA-FKF (Plasmid #79889) - Sauka-Spengler lab plasmid
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEM BirA-2A-Citrine-SV40pA-FRT-Kan-FRT was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 89890 ; http://n2t.net/addgene:89890 ; RRID:Addgene_89890)

  • For your References section:

    Generation of a double binary transgenic zebrafish model to study myeloid gene regulation in response to oncogene activation in melanocytes. Kenyon A, Gavriouchkina D, Zorman J, Chong-Morrison V, Napolitani G, Cerundolo V, Sauka-Spengler T. Dis Model Mech. 2018 Apr 6;11(4). pii: dmm.030056. doi: 10.1242/dmm.030056. 10.1242/dmm.030056 PubMed 29666124
Related items: