pCrysβ:ECFP-LexOP:mCherry-NRasQ61K
(Plasmid #89886)

• Purpose: Human NRasQ61K fused to mCherry downstream of LexOP, placed within a non-autonomous maize dissociation (Ds) element for integration in zebrafish. Contains pCrysB-ECFP for screening.
• Depositing Lab: Tatjana Sauka-Spengler
• Publication: Kenyon et al Dis Model Mech. 2018 Apr 6;11(4). pii: dmm.030056. doi: 10.1242/dmm.030056.

Backbone

• Vector backbone: pDs(cry:ECFP-LexOP:Cherry)
• Backbone size w/o insert (bp): 6280
• Total vector size (bp): 7585
• Vector type: Unspecified

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry-NRasQ61K
• Species: H. sapiens (human)
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTCGACTCTAGGATCTTCGCA
• 3′ sequencing primer: GGGAGGTGTGGGAGGTTTT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pBabe-NRas 61K (plasmid #12543; Addgene) pDs(cry:ECFP-LexOP:Cherry) construct was from Dr Alexander Emelyanov and Dr Sergey Parinov

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry