pGL3-Basic-Fascin-Promoter (-210-0)
(Plasmid
#89826)
-
PurposeFascin promoter for luciferase assay
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89826 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL3-Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 4818
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFascin1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)354
-
GenBank IDNM_003088.3
-
Entrez GeneFSCN1 (a.k.a. FAN1, HSN, SNL, p55)
- Promoter SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site Hind III (not destroyed)
- 5′ sequencing primer CC CTCGAG GGTTGTGAGGGGTGATGTCCT
- 3′ sequencing primer GG AAGCTT ggtggcagtagacgagaggc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-Basic-Fascin-Promoter (-210-0) was a gift from Shengyu Yang (Addgene plasmid # 89826 ; http://n2t.net/addgene:89826 ; RRID:Addgene_89826) -
For your References section:
GATA3 transcription factor abrogates Smad4 transcription factor-mediated fascin overexpression, invadopodium formation, and breast cancer cell invasion. Sun J, He H, Pillai S, Xiong Y, Challa S, Xu L, Chellappan S, Yang S. J Biol Chem. 2013 Dec 27;288(52):36971-82. doi: 10.1074/jbc.M113.506535. Epub 2013 Nov 14. 10.1074/jbc.M113.506535 PubMed 24235142