pSUPER-retro-puro-shSTIM1
(Plasmid
#89816)
-
PurposeKnockdown human STIM1 expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89816 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSUPER-puro
-
Backbone manufactureroligoengine
- Backbone size w/o insert (bp) 4400
- Total vector size (bp) 4400
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSTIM1 shRNA
-
gRNA/shRNA sequenceAGAAGGAGCTAGAATCTCAC
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001277961.1
-
Entrez GeneSTIM1 (a.k.a. D11S4896E, GOK, IMD10, STRMK, TAM, TAM1)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSUPER-retro-puro-shSTIM1 was a gift from Shengyu Yang (Addgene plasmid # 89816 ; http://n2t.net/addgene:89816 ; RRID:Addgene_89816) -
For your References section:
STIM1- and Orai1-mediated Ca(2+) oscillation orchestrates invadopodium formation and melanoma invasion. Sun J, Lu F, He H, Shen J, Messina J, Mathew R, Wang D, Sarnaik AA, Chang WC, Kim M, Cheng H, Yang S. J Cell Biol. 2014 Nov 24;207(4):535-48. doi: 10.1083/jcb.201407082. Epub 2014 Nov 17. 10.1083/jcb.201407082 PubMed 25404747