pBSU6-shTOM40.3
(Plasmid
#89796)
-
PurposeExpresses shRNA against TOM40.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89796 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBSU6
- Backbone size w/o insert (bp) 3292
- Total vector size (bp) 3304
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA Tom40
-
gRNA/shRNA sequenceGGCACTGTCATGTCTCTAGCT
-
SpeciesM. musculus (mouse)
- Promoter U6
-
Tag
/ Fusion Protein
- none
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ApaI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GTAAAACGACGGCCAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBSU6-shTOM40.3 was a gift from Robert Friedlander (Addgene plasmid # 89796 ; http://n2t.net/addgene:89796 ; RRID:Addgene_89796) -
For your References section:
Inhibition of mitochondrial protein import by mutant huntingtin. Yano H, Baranov SV, Baranova OV, Kim J, Pan Y, Yablonska S, Carlisle DL, Ferrante RJ, Kim AH, Friedlander RM. Nat Neurosci. 2014 Jun;17(6):822-31. doi: 10.1038/nn.3721. Epub 2014 May 18. 10.1038/nn.3721 PubMed 24836077