pAAV-IRES-hrGFP-mWnt5a
(Plasmid
#89772)
-
PurposeExpresses mouse Wnt5a in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89772 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-IRES-hrGFP
-
Backbone manufacturerAgilent Technologies
- Backbone size w/o insert (bp) 6100
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemouse Wnt5a
-
SpeciesM. musculus (mouse)
-
Entrez GeneWnt5a (a.k.a. 8030457G12Rik, Wnt-5a)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATTCTGAGTCCAAGCTAGGC (beta-globin)
- 3′ sequencing primer TAGAAGGACACCTAGTCAGA (hGH polyA) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-IRES-hrGFP-mWnt5a was a gift from Ken-Ichi Takemaru (Addgene plasmid # 89772 ; http://n2t.net/addgene:89772 ; RRID:Addgene_89772) -
For your References section:
Abrogation of beta-catenin signaling in oligodendrocyte precursor cells reduces glial scarring and promotes axon regeneration after CNS injury. Rodriguez JP, Coulter M, Miotke J, Meyer RL, Takemaru K, Levine JM. J Neurosci. 2014 Jul 30;34(31):10285-97. doi: 10.1523/JNEUROSCI.4915-13.2014. 10.1523/JNEUROSCI.4915-13.2014 PubMed 25080590