Skip to main content
Addgene

pX335A_hCas9(D10A)_IRF8gRNA4
(Plasmid #89722)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89722 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)
  • Backbone manufacturer
    Feng Zhang lab, modified by Boris Greber lab
  • Backbone size w/o insert (bp) 10827
  • Total vector size (bp) 10829
  • Modifications to backbone
    1. Puromycin resistance-2A-GFP cassette (previously introduced by Boris Greber lab) 2. IRF8 gRNA4
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IRF8 gRNA4
  • gRNA/shRNA sequence
    human IRF8 locus (Intron 2 - Exon 3 boundary)
  • Species
    H. sapiens (human)
  • GenBank ID
    3394
  • Entrez Gene
    IRF8 (a.k.a. H-ICSBP, ICSBP, ICSBP1, IMD32A, IMD32B, IRF-8)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer actatcatatgcttaccgtaac
  • 3′ sequencing primer aacgccaatagggactttcc
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Original vector from Feng Zhang lab (pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A), Plasmid #42335) was modified from Boris Greber lab with a Puromycin resistance-2A-GFP cassette (Zhang M, D'Aniello C, Verkerk AO et al. Recessive cardiac phenotypes in induced pluripotent stem cell models of Jervell and Lange-Nielsen syndrome: disease mechanisms and pharmacological rescue. Proc Natl Acad Sci USA 2014;111:E5383-E5392.).
This backbone was used for IRF8 gRNA cloning.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX335A_hCas9(D10A)_IRF8gRNA4 was a gift from Martin Zenke (Addgene plasmid # 89722 ; http://n2t.net/addgene:89722 ; RRID:Addgene_89722)

  • For your References section:

    Modelling IRF8 Deficient Human Hematopoiesis and Dendritic Cell Development with Engineered iPS Cells. Sontag S, Forster M, Qin J, Wanek P, Mitzka S, Schuler HM, Koschmieder S, Rose-John S, Sere K, Zenke M. Stem Cells. 2017 Jan 16. doi: 10.1002/stem.2565. 10.1002/stem.2565 PubMed 28090699
Related items: