pX335A_hCas9(D10A)_IRF8gRNA1
(Plasmid #89719)

• Purpose: Knockout IRF8 in human cells
• Depositing Lab: Martin Zenke
• Publication: Sontag et al Stem Cells. 2017 Jan 16. doi: 10.1002/stem.2565.

Backbone

• Vector backbone: pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)
• Backbone manufacturer: Feng Zhang lab, modified by Boris Greber lab
• Backbone size w/o insert (bp): 10827
• Total vector size (bp): 10829
• Modifications to backbone: 1. Puromycin resistance-2A-GFP cassette (previously introduced by Boris Greber lab) 2. IRF8 gRNA1
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: IRF8 gRNA1
• gRNA/shRNA sequence: human IRF8 locus (Intron 2 - Exon 3 boundary)
• Species: H. sapiens (human)
• GenBank ID: 3394
• Entrez Gene: IRF8 (a.k.a. H-ICSBP, ICSBP, ICSBP1, IMD32A, IMD32B, IRF-8)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: actatcatatgcttaccgtaac
• 3′ sequencing primer: aacgccaatagggactttcc

Resource Information

• Supplemental Documents:
  • Design of gRNA for CRISPR-Cas9n directed deletion of IRF8

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Original vector from Feng Zhang lab (pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A), Plasmid #42335) was modified from Boris Greber lab with a Puromycin resistance-2A-GFP cassette (Zhang M, D'Aniello C, Verkerk AO et al. Recessive cardiac phenotypes in induced pluripotent stem cell models of Jervell and Lange-Nielsen syndrome: disease mechanisms and pharmacological rescue. Proc Natl Acad Sci USA 2014;111:E5383-E5392.).
This backbone was used for IRF8 gRNA cloning.