-
PurposeMammalian expression plasmid for zinc finger nuclease targeting human AAVS1 locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89707 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMVpA
- Total vector size (bp) 5772
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZFN-AAVS1
-
Insert Size (bp)2127
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (unknown if destroyed)
- 3′ cloning site Acc65I (unknown if destroyed)
- 5′ sequencing primer GACGCAAATGGGCGGTAG
- 3′ sequencing primer CTATTGCTTTATTTGTAACCATTATAAGCTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-ZFN-AAVS1 was a gift from Dmitriy Mazurov (Addgene plasmid # 89707 ; http://n2t.net/addgene:89707 ; RRID:Addgene_89707) -
For your References section:
Gene Editing in Human Lymphoid Cells: Role for Donor DNA, Type of Genomic Nuclease and Cell Selection Method. Zotova A, Lopatukhina E, Filatov A, Khaitov M, Mazurov D. Viruses. 2017 Nov 2;9(11). pii: v9110325. doi: 10.3390/v9110325. 10.3390/v9110325 PubMed 29099045