M249-5'csr-1-Pgsy-1-luciferase-Bar-3'csr-1
(Plasmid #89693)

• Purpose: Luciferase reporter plasmid targeted at csr-1 locus
• Depositing Lab: Christian Hong
• Publication: Matsu-Ura et al Fungal Biol Biotechnol. 2015 Jul 15;2:4. doi: 10.1186/s40694-015-0015-1. eCollection 2015.

Backbone

• Vector backbone: pRS426
• Backbone manufacturer: ATCC
• Backbone size w/o insert (bp): 5726
• Total vector size (bp): 10073
• Modifications to backbone: 5' and 3' csr-1 UTR for targeting to csr-1 locus. Luciferase expression under the control of gsy-1 promoter for reporter assay.
• Vector type: Yeast episomal vector
• Selectable markers: URA3 ; glyphosate (BAR gene for selection: encoding bialaphos/PPT resistance)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: gsy-1 promoter, luciferase
• Alt name: gsy-1, luc
• Species: N. crassa
• Insert Size (bp): 6091
• Promoter: gsy-1
• Tag / Fusion Protein:
  • luciferase

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CTTTGGATAGCTCTTGCCAGC
• 3′ sequencing primer: CTGTTGCCGGTCTTGCGATG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry