pSB1A3_GFP_dT34
(Plasmid
#89669)
-
Purposeexpression of doubleTAL staple protein dT34 with N-terminally fused cycle3-GFP
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89669 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepSB1A3
-
Backbone manufacturerigem parts registry
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP_dT34
-
SpeciesSynthetic
-
Insert Size (bp)6000
- Promoter T7
-
Tag
/ Fusion Protein
- His6 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer attaccgcctttgagtgagc
- 3′ sequencing primer tgccacctgacgtctaagaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB1A3_GFP_dT34 was a gift from Hendrik Dietz (Addgene plasmid # 89669 ; http://n2t.net/addgene:89669 ; RRID:Addgene_89669) -
For your References section:
Self-assembly of genetically encoded DNA-protein hybrid nanoscale shapes. Praetorius F, Dietz H. Science. 2017 Mar 24;355(6331). pii: eaam5488. doi: 10.1126/science.aam5488. 10.1126/science.aam5488 PubMed 28336611
