pcDNA3.1-dCas9-MQ1(C141S)-EGFP
(Plasmid
#89635)
-
PurposeTargeted CpG methylation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89635 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerinvitrogene
- Backbone size w/o insert (bp) 5382
- Total vector size (bp) 11637
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersNeomycin (select with G418) ; EGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesite-specific DNA-methyltransferase SssI
-
Alt namedCas9-MQ1(C141S)
-
SpeciesSynthetic; Spiroplasma sp. (strain MQ1)
-
Insert Size (bp)1164
-
MutationC141S, TGC-->TCC
-
GenBank IDP15840.3
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3*FLAG (N terminal on insert)
- T2A-EGFP (C terminal on insert)
- 6*His (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site NheI (destroyed during cloning)
- 5′ sequencing primer GCGCCCTAGGGACAGCAAAGTGGAGAACAAAACA
- 3′ sequencing primer GCGCCCTAGGGCCGCCGATCTTGTCAATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-dCas9-MQ1(C141S)-EGFP was a gift from Margaret Goodell (Addgene plasmid # 89635 ; http://n2t.net/addgene:89635 ; RRID:Addgene_89635) -
For your References section:
Targeted DNA methylation in vivo using an engineered dCas9-MQ1 fusion protein. Lei Y, Zhang X, Su J, Jeong M, Gundry MC, Huang YH, Zhou Y, Li W, Goodell MA. Nat Commun. 2017 Jul 11;8:16026. doi: 10.1038/ncomms16026. 10.1038/ncomms16026 PubMed 28695892