pTH858-gst-optec V156E
(Plasmid
#89592)
-
PurposePlasmid for bacterial expression of a His-tagged V156E mutant of GST encoded by preferred codons
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89592 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5240
- Total vector size (bp) 5935
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameglutathione-S transferase V156E mutant, codon-optimised for bacterial expression
-
Speciessynthetic construct
-
Insert Size (bp)695
-
Mutationchanged valine 156 to glutamic acid
-
GenBank IDLT799420.1
- Promoter T7
-
Tag
/ Fusion Protein
- 8xhistidine (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGCGCCAGCAACCGCACCTGTGGC
- 3′ sequencing primer GCGCCGCTACAGGGCGCGTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTH858-gst-optec V156E was a gift from Tobias von der Haar (Addgene plasmid # 89592 ; http://n2t.net/addgene:89592 ; RRID:Addgene_89592) -
For your References section:
Codon-Dependent Translational Accuracy Controls Protein Quality in Escherichia coli but not in Saccharomyces cerevisiae. Jossé L, Sampson CDD, Tuite MF, Howland K, von der Haar T. bioRxiv 200006 10.1101/200006