pET22b-csgB
(Plasmid #89582)

• Purpose: Express csgB curli protein with GS linker and Histaq
• Depositing Lab: Urartu Seker
• Publication: Abdelwahab et al Langmuir. 2017 Apr 7. doi: 10.1021/acs.langmuir.7b00112.

Backbone

• Vector backbone: pET-22b(+)
• Backbone size w/o insert (bp): 5405
• Total vector size (bp): 5927
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: csgB
• Alt name: minor curli subunit
• Insert Size (bp): 552
• Entrez Gene: csgB (a.k.a. b1041, ECK1027)
• Tags / Fusion Proteins:
  • 3xGGSG linker - TEV site - 3xGGSG linker (C terminal on insert)
  • 6xHis tag (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (unknown if destroyed)
• 3′ cloning site: KpnI (unknown if destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry