pEF6 rglut1 HA complete
(Plasmid
#89572)
-
Purposerglut1 HA complete
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89572 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEF6
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepEF6 rglut1 HA complete
-
SpeciesR. norvegicus (rat)
-
Entrez GeneSlc2a1 (a.k.a. GLUTB, GTG1, Glut1, Gtg3, RATGTG1)
- Promoter EF-1α
-
Tags
/ Fusion Proteins
- rglut1 HA complete (N terminal on insert)
- V5-His A, B, C (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF6 rglut1 HA complete was a gift from Jeffrey Rathmell (Addgene plasmid # 89572 ; http://n2t.net/addgene:89572 ; RRID:Addgene_89572) -
For your References section:
Cytokine stimulation promotes glucose uptake via phosphatidylinositol-3 kinase/Akt regulation of Glut1 activity and trafficking. Wieman HL, Wofford JA, Rathmell JC. Mol Biol Cell. 2007 Apr;18(4):1437-46. Epub 2007 Feb 14. 10.1091/mbc.e06-07-0593 PubMed 17301289