AAV-syn-ChR2-Kv-P2A-H2b-mRuby2
(Plasmid #89570)

• Purpose: Channelrhodopsin localized to neuronal soma with simultaneous nuclear labeling
• Depositing Lab: McLean Bolton
• Publication: Baker et al Elife. 2016 Aug 15;5. pii: e14193. doi: 10.7554/eLife.14193.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4548
• Total vector size (bp): 6944
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Channelrhodopsin
• Alt name: ChR2
• Insert Size (bp): 1137
• Mutation: H134R
• Promoter: synapsin

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: atggactatggcggcgctttgtctgccg

Gene/Insert 2

• Gene/Insert name: Histone 2B
• Alt name: H2B
• Alt name: hist1h2bb
• Species: M. musculus (mouse)
• Insert Size (bp): 1151
• Tag / Fusion Protein:
  • mRuby2 (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ctgttaaagcaagcaggagacgtggaagaaaaccccggtcctggttctATGCCAGAGCCAGCGAA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry