-
PurposeCloning backbone for sgRNA, also has a barcode that allows detection from scRNA-seq
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89493 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneplenti
- Backbone size w/o insert (bp) 10000
- Total vector size (bp) 8401
-
Modifications to backboneThe sgRNA and Cas9 gene were replaced with sgRNA(MS2) backbone and an barcode insertion region was introduced between WPRE and 3'LTR.
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsOnly amplify in recombinase deficient bacteria (eg. Stbl3 or HST08).
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA (with MS2 loop)
-
Alt namelentiGuide Barcode
-
gRNA/shRNA sequenceempty backbone
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCTTGTGGAAAGGACGAAACACCGGAGACGGGATACC
- 3′ sequencing primer ctcaagatctagttacgccaagcttAAAAAAgcaccgact (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-sgRNA(MS2)-puro-barcode was a gift from Gary Hon (Addgene plasmid # 89493 ; http://n2t.net/addgene:89493 ; RRID:Addgene_89493) -
For your References section:
Multiplexed Engineering and Analysis of Combinatorial Enhancer Activity in Single Cells. Xie S, Duan J, Li B, Zhou P, Hon GC. Mol Cell. 2017 Apr 20;66(2):285-299.e5. doi: 10.1016/j.molcel.2017.03.007. Epub 2017 Apr 13. 10.1016/j.molcel.2017.03.007 PubMed 28416141