Addgene: GFP-Rab27B GG Skip to main content
Addgene

GFP-Rab27B GG
(Plasmid #89451)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89451 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    peGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5350
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human Rab27B GG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    650
  • Mutation
    GG (geranyl geranyl site is mutated)
  • GenBank ID
    XM_017025913.1
  • Entrez Gene
    RAB27B (a.k.a. C25KG)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-Rab27B GG was a gift from Wendy Westbroek (Addgene plasmid # 89451 ; http://n2t.net/addgene:89451 ; RRID:Addgene_89451)
  • For your References section:

    Effect of the secretory small GTPase Rab27B on breast cancer growth, invasion, and metastasis. Hendrix A, Maynard D, Pauwels P, Braems G, Denys H, Van den Broecke R, Lambert J, Van Belle S, Cocquyt V, Gespach C, Bracke M, Seabra MC, Gahl WA, De Wever O, Westbroek W. J Natl Cancer Inst. 2010 Jun 16;102(12):866-80. doi: 10.1093/jnci/djq153. Epub 2010 May 18. 10.1093/jnci/djq153 PubMed 20484105