Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GFP-Rab27B
(Plasmid #89447)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89447 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    peGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5350
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human Rab27B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    650
  • Mutation
    wild type
  • GenBank ID
    XM_017025913.1
  • Entrez Gene
    RAB27B (a.k.a. C25KG)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-Rab27B was a gift from Wendy Westbroek (Addgene plasmid # 89447 ; http://n2t.net/addgene:89447 ; RRID:Addgene_89447)
  • For your References section:

    Effect of the secretory small GTPase Rab27B on breast cancer growth, invasion, and metastasis. Hendrix A, Maynard D, Pauwels P, Braems G, Denys H, Van den Broecke R, Lambert J, Van Belle S, Cocquyt V, Gespach C, Bracke M, Seabra MC, Gahl WA, De Wever O, Westbroek W. J Natl Cancer Inst. 2010 Jun 16;102(12):866-80. doi: 10.1093/jnci/djq153. Epub 2010 May 18. 10.1093/jnci/djq153 PubMed 20484105