-
PurposeGLUT1 construct
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89440 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEF6
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGLUT1
-
SpeciesR. norvegicus (rat)
-
GenBank IDNM_138827.1
-
Entrez GeneSlc2a1 (a.k.a. GLUTB, GTG1, Glut1, Gtg3, RATGTG1)
- Promoter EF-1a
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GLUT1-GFP was a gift from Jeffrey Rathmell (Addgene plasmid # 89440 ; http://n2t.net/addgene:89440 ; RRID:Addgene_89440) -
For your References section:
An essential role for the Glut1 PDZ-binding motif in growth factor regulation of Glut1 degradation and trafficking. Wieman HL, Horn SR, Jacobs SR, Altman BJ, Kornbluth S, Rathmell JC. Biochem J. 2009 Mar 1;418(2):345-67. doi: 10.1042/BJ20081422. 10.1042/BJ20081422 PubMed 19016655