Skip to main content
Addgene

E1b-GFP-Tol2-Gateway dre SE-zic2a R
(Plasmid #89387)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89387 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    E1b-GFP-Tol2-Gateway
  • Backbone manufacturer
    Nadav Ahituv lab
  • Total vector size (bp) 11068
  • Modifications to backbone
    Insertion of super-enhancer region

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    zic2a
  • Alt name
    super-enhancer zic2a
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1741
  • Entrez Gene
    zic2a (a.k.a. cb851, fb26a03, wu:fb26a03, zic2, zic2.1)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATTTCCAAAGTATCAAGTGACACA
  • 3′ sequencing primer GACCTCAAACAGGAATCTGGAC
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    E1b-GFP-Tol2-Gateway dre SE-zic2a R was a gift from Alena Shkumatava (Addgene plasmid # 89387 ; http://n2t.net/addgene:89387 ; RRID:Addgene_89387)

  • For your References section:

    Comparative analyses of super-enhancers reveal conserved elements in vertebrate genomes. Perez-Rico YA, Boeva V, Mallory AC, Bitetti A, Majello S, Barillot E, Shkumatava A. Genome Res. 2017 Feb;27(2):259-268. doi: 10.1101/gr.203679.115. Epub 2016 Dec 13. 10.1101/gr.203679.115 PubMed 27965291
Related items: