E1b-GFP-Tol2-Gateway mmu SE-Irf2bpl K
(Plasmid
#89380)
-
PurposeVector for reporter assay of one mouse super-enhancer region
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89380 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneE1b-GFP-Tol2-Gateway
-
Backbone manufacturerNadav Ahituv lab
- Total vector size (bp) 11156
-
Modifications to backboneInsertion of super-enhancer region
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIrf2bpl
-
Alt namesuper-enhancer Irf2bpl
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1829
-
Entrez GeneIrf2bpl (a.k.a. 6430527G18Rik, Eap1)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGAAAGAGGTACTCCCAAGGGTT
- 3′ sequencing primer CAACCTACCATATCTCTCCTCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
E1b-GFP-Tol2-Gateway mmu SE-Irf2bpl K was a gift from Alena Shkumatava (Addgene plasmid # 89380 ; http://n2t.net/addgene:89380 ; RRID:Addgene_89380) -
For your References section:
Comparative analyses of super-enhancers reveal conserved elements in vertebrate genomes. Perez-Rico YA, Boeva V, Mallory AC, Bitetti A, Majello S, Barillot E, Shkumatava A. Genome Res. 2017 Feb;27(2):259-268. doi: 10.1101/gr.203679.115. Epub 2016 Dec 13. 10.1101/gr.203679.115 PubMed 27965291