pOD2087-trnDEG
(Plasmid #89369)

• Purpose: MosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pmec-18 (touch neuron specific).
• Depositing Lab: Karen Oegema
• Publication: Wang et al Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.

Backbone

• Vector backbone: pCFJ151
• Backbone manufacturer: Christian Frøkjær-Jensen (Erik Jorgensen lab)
• Backbone size w/o insert (bp): 7328
• Total vector size (bp): 11150
• Vector type: Targeting vector for Mos1 transposon mediated single copy transgene insertion
• Selectable markers: Cb-unc-119(+)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: vhhGFP4-ZIF-1
• Species: C. elegans (nematode), Synthetic
• Insert Size (bp): 2098
• Entrez Gene: zif-1 (a.k.a. CELE_F59B2.6)
• Promoter: Pmec-18
• Tag / Fusion Protein:
  • vhhGFP4 (GFP nanobody) (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgtaaaacgacggccagt
• 3′ sequencing primer: CGACTCACTAGTGGGCAGAT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry